Therya_notes_NE2

THERYA NOTES 2024, Vol. 5 : 92-102 DOI: 10.12933/therya_notes-24-156 ISSN 2954-3614

First record of Coxiella sp. in Ornithodoros hasei parasitizing Rhogeessa tumida in México

Primer registro de Coxiella sp. en Ornithodoros hasei parasitando a Rhogeessa tumida en México

Estefanía Grostieta1, Sebastián Muñoz-Leal2, Héctor M. Zazueta-Islas1, Marlene Solís-Cortés1, Fernanda Flores-Vázquez1, Gerardo G. Ballados-González3, Pablo Colunga-Salas1,4, Ingeborg Becker1, Juan Manuel Pech-Canché5, and Sokani Sánchez-Montes1,5*

1Centro de Medicina Tropical, Unidad de Investigación en Medicina Experimental, Facultad de Medicina, Universidad Nacional Autónoma de México. Dr. Balmis 148, C. P. 06726, Ciudad de México. Ciudad de México, México. E-mail: estefania.grostieta@ciencias.unam.mx (E-G); manuzazueta@ciencias.unam.mx (HM-ZI); marlenesolis@ciencias.unam.mx (M-SC); ferflores@ciencias.unam.mx (F-FV); becker@unam.mx (I-B).

2Departamento de Ciencia Animal, Facultad de Ciencias Veterinarias, Universidad de Concepción. Av. Vicente Méndez 595, Chillán. Concepción, Chile. E- mail: sebamunoz@udec.cl (S-ML).

3Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana. Miguel Ángel de Quevedo s/n, esq. Yáñez, C. P. 91710, Veracruz. Veracruz, México. E-mail: balladosgerardo506@hotmail.com (GG-BG).

4Instituto de Biotecnología y Ecología Aplicada, Universidad Veracruzana. Campus para la Cultura, las Artes y el Deporte, Cultura Veracruzana No. 101, Emiliano Zapata, C. P. 91090, Xalapa de Enríquez. Veracruz, México. E-mail: pcolunga@uv.mx (P-CS).

5Facultad de Ciencias Biológicas y Agropecuarias región Poza Rica-Tuxpan, Universidad Veracruzana. Carretera Tuxpan Tampico Kilómetro 7.5 Universitaria, C. P. 92870, Tuxpan de Rodríguez Cano. Veracruz, México. E-mail: jmpech@uv.mx (JM-PC); sok10108@gmail.com (S-SM).

*Corresponding author

Soft ticks represent a neglected group of ectoparasites associated with a wide range of vertebrates. In México, 24 species have been reported, the majority parasitizing bats. Several species are competent vectors of a wide range of pathogenic microorganisms. For this reason, the aim of the present work was to identify ticks associated with bats from Tuxpan de Rodriguez Cano, Veracruz, México. Bats were captured using mist nets and were visually inspected for tick presence. The ectoparasites were identified morphologically and molecularly with the use of the mitochondrial marker 16SrDNA, and molecular detection of several bacterial and protozoan pathogens was also performed. Twenty-five bats of 9 species were inspected. We collected 7 tick larvae morphologically identified as Ornithodoros hasei from a female black-winged little yellow bat (Rhogeessa tumida). Sequencing of the 400-bp fragment of the 16S rDNA gene, demonstrated a similarity of 96 % (373/388 bp) with O. hasei from Argentina and Brazil. In addition, the presence of Coxiella sp. was confirmed. Our findings provide relevant information on the biology of O. hasei by identifying R. tumida as a new host, providing the most north-eastern record for the geographical distribution of this tick in the Gulf of México and detecting the presence of a new endosymbiont in this tick.

Key words: Bats; biodiversity; ectoparasites; endosymbiont; México; soft tick.

Las garrapatas blandas representan un grupo desatendido de ectoparásitos asociadas con una amplia gama de vertebrados. En México se han reportado 24 especies, la mayoría parasitando murciélagos. Varias especies son vectores competentes de una amplia gama de microorganismos patógenos. Por esta razón, el objetivo del presente trabajo fue identificar garrapatas asociadas con murciélagos de Tuxpan de Rodríguez Cano, Veracruz, México. Los murciélagos fueron capturados usando redes de niebla y fueron inspeccionados visualmente para detectar la presencia de garrapatas. Los ectoparásitos se identificaron morfológica y molecularmente con el uso del marcador mitocondrial 16SrDNA. Adicionalmente, se realizó la detección molecular de varios patógenos bacterianos y protozoarios. Se inspeccionaron 25 murciélagos de 9 especies. Se recolectaron 7 larvas de garrapatas identificadas morfológicamente como Ornithodoros hasei de una hembra de murciélago amarillo de alas negras (Rhogeessa tumida). La secuenciación del fragmento de 400 pb del gen 16S rDNA demostró una similitud del 96 % (373/388 pb) con O. hasei de Argentina y Brasil. Adicionalmente, se confirmó la presencia de Coxiella sp. Nuestros hallazgos proporcionan información relevante sobre la biología de O. hasei al identificar a R. tumida como un nuevo huésped, proporcionando el registro más nororiental para la distribución geográfica de esta garrapata en el Golfo de México y detectando la presencia de un nuevo huésped-endosimbionte en esta garrapata.

Palabras clave: Biodiversidad; ectoparásitos; endosimbionte; garrapatas blandas; México; murciélagos.

Ticks are hematophagous ectoparasites associated with a great variety of vertebrates, among which mammals stand out. The existence of 3 living families and a fossil one is recognized, among which the soft ticks of the Argasidae family are prominent members. Currently, this family is composed by near 220 known species, which exhibit nesting behavior, as they remain within the dens of the hosts and feed on multiple occasions throughout their life cycle (Mans et al. 2019). Soft ticks are vectors of a wide range of pathogenic microorganisms, among which members of the genera Borrelia and Rickettsia are recognized (Parola and Raoult 2001). In particular, many members of the genus Ornithodoros are parasites of bats (Sándor et al. 2021).

Twenty-four species of the genus Ornithodoros occur in México, more than half of them are associated with bats (Guzmán-Cornejo et al. 2019). However, in the country, information on microorganisms related to Ornithodoros that parasitize bats is scarce and scattered. A single record described Rickettsia lusitaniae in Ornithodoros yumatensis from the Yucatán Peninsula, and in an undetermined Ornithodoros sp. of unknown geographic origin (Sánchez-Montes et al. 2016; Hornok et al. 2019). Nevertheless, in other countries of the Neotropical region, a wide range of potentially zoonotic microorganisms (e.g., Borrelia sp.) have been identified in ticks parasitizing bats of the Emballonuridae, Mormoopidae, Noctilionidae, Phyllostomidae and Vespertilionidae families (Muñoz-Leal et al. 2021).

Ornithodoros hasei, a member of the Ornithodoros talaje group, is one of the most common and abundant soft ticks associated with bats across the Neotropical region and exhibits a wide distribution that ranges from northern México to Argentina (Colombo et al. 2020). This species has been recorded in association with 42 species of 26 genera of bats of the Emballonuridae, Mormoopidae, Noctilionidae, Phyllostomidae and Vespertilionidae families and 1 rodent species in 11 countries of the Neotropical region (Figure 1; Appendix 1). In México, records of O. hasei are scarce, with a first report made in the states of Yucatán and Sinaloa in 1963, and again in 2000 for both states (Kohls et al. 1965; Guzmán-Cornejo et al. 2019).

This tick species has recently been studied in South America for the presence of microorganisms, among which the presence of Candidatus Rickettsia wissemanii stands out, a new species from the spotted fever group (whose pathogenicity is unknown), which was detected in Argentina, Brazil, and French Guiana (Tahir et al. 2016; Luz et al. 2019; Colombo et al. 2020). Additionally, an uncharacterized member of the Bartonella genus has been detected in French Guiana (Davoust et al. 2016). However, no studies have been performed to identify other potentially pathogenic bacterial or parasitic agents in this tick species.

The aim of this study was to perform a morphological and molecular identification of soft ticks collected from bats, and to provide new records of tick-bat associations in México. Moreover, we aimed to detect tick-borne bacteria (Anaplasma, Bartonella, Borrelia, Coxiella, Ehrlichia, and Rickettsia) and protozoa (Babesia and Hepatozoon) in the collected ticks.

During a field journey on February 27, 2020, we trapped bats using mist nets at the ecotourism centre San Basilio (20º 58´03´´N, 97º 21´ 12´´W) located in the municipality of Tuxpan de Rodríguez Cano, Veracruz. Bats were collected from 20 to 22 hr. The specimens were carefully removed from the nets, identified with the help of specialized morphological keys of Medellín et al. (2007), and individualized in blanket bags. Each specimen was checked externally for the presence of ticks, which were collected with the help of forceps and fixed in 70 % ethanol. Once the procedure was finished, the mammals were released in situ.

For DNA extraction from ticks, a small incision was made behind the fourth pair of legs with a sterile needle for each specimen. Subsequently, the individuals were placed in a Cheelex-100 solution following the methodology of Aguilar-Domínguez et al. (2019). The exoskeletons were recovered and mounted on semi-permanent slides using Hoyer’s medium to perform a morphological identification following Kohls et al. (1965). For molecular identification of the specimens, a 400-bp fragment of the mitochondrial 16S rRNA gene was amplified using the primers and thermal conditions according to Norris et al. (1996). Subsequently, conventional polymerase chain reactions (PCRs) were performed using specific primers to detect of several bacterial and protozoan pathogens, which are listed in Appendix 2. The reaction mixture was prepared in a final volume of 25 μL, using 12.5 μL of 2× GoTaq Green Master Mix (Promega Corporation, Madison, WI, USA), 2 μL of primers (2 μM, 1 μL each), 8.5 μL nuclease-free water and 500 ng DNA of each sample (2 μL).

Negative (nuclease free water) and positive (DNA of Anaplasma ovis [MG733099], Bartonella vinsonii vinsonii [KT326174], Ehrlichia canis [MH917714], Hepatozoon sp. from Crotalus molossus [MT385834], Rickettsia amblyommatis [KX363842], and Theileria equi [MT828308]) controls were included. Amplicons were sequenced at Macrogen, Korea. Finally, the sequences generated were compared to those deposited in GenBank using the BLAST-n tool. Additionally, for ticks and tick-borne pathogens, we made a phylogenetic reconstruction using the Maximum Likelihood method. We selected the best nucleotide substitution model using the Bayesian information criterion (BIC) and the maximum likelihood value (lnL) in MEGA v.10. Branch support was estimated using 10000 non-parametric bootstraps. Finally, to ascertain genetic diversity between the tick populations recovered in this study and those deposited in GenBank, we calculated the number of haplotypes and the number of unique haplotypes in DNAsp 5.10. To identify the relationship among haplotypes, minimal union networks were constructed using the program PopArt.

Bats collected correspond to 9 species of 2 families: Phyllostomidae (23 specimens: 15 Artibeus jamaicensis, 1 Artibeus lituratus, 3 Chiroderma salvini, 1 Dermanura phaeotis, 1 Glossophaga soricina, 1 Platyrrhinus helleri, and 1 Sturnira ludovici) and Vespertilionidae (2 specimens: 1 Epistecus furinalis, and 1 Rhogeesa tumida). A single R. tumida female was recorded to be infested by ticks. A total of 7 larvae were identified morphologically as O. hasei, because of the following traits: dorsal plate pyriform, 14 pairs of dorsolateral setae and 4 pairs of central setae; pointed hypostome with 3 rows of denticles (19 denticles in row I; 18 in row II, and 9 in row III); dentition formula 3/3 in the anterior two-thirds, then 2/2 towards the base (Figure 2a-c; Kohls et al. 1965). We recovered 400-bp sequences of the 16S-rRNA gene from all collected specimens. The sequences showed a similarity of 99 %–100 % (388/399 bp) among each other and 96 % (373/388 bp) with sequences of O. hasei from Brazil and Argentina (GenBank accession numbers MH600060 and MT077216). The phylogenetic analysis confirmed the identity of the species, grouping the reference sequences with those generated in the present work in a monophyletic clade with a support value of 99 % (Figure 2d).

We detected the presence of 9 haplotypes of O. hasei (Figure 2b). The most frequent haplotype detected was H5, with 3 sequences (27.3 %), followed by haplotype H2 with 2 (18.2 %). The remaining haplotypes were recorded once each one. None of the haplotypes was detected in more than one country. In México, only 2 haplotypes were detected that differ between 12 and 13 mutational steps with the other haplotypes detected in South America (Figure 2e).

For tick-borne pathogen detection, all ticks were tested individually by PCR. Of these, 2 ticks (28.5 %) produced the expected PCR products for the 16S-rRNA gene of Coxiella. The sequences obtained were 100 % (615/615 bp) identical to each other; according to the BLAST analysis, our sequences were 99 % (610/615 bp) identical to that of the C. burnetii isolate of Hyalomma asiaticum from China (GenBank accession number MN880312). The phylogenetic analysis grouped our sequences in a monophyletic clade (support value of 95 %) with those of Coxiella endosymbionts isolated from other Ornithodoros species and several linages of C. burnetii, which belong to clade A (Figure 3).

The presence of DNA from other bacterial or parasitic agents was not detected. The obtained sequences were deposited in GenBank under the following accessions numbers: Ornithodoros 16S-rDNA (OL881234-36), and Coxiella 16S-rDNA (OL898409).

In México, records of ticks associated with bats of the Vespertilionidae family are scarce, with only 5 host species examined (Corynorhinus mexicanus, Myotis nigricans extremus, M. velifer, M. vivesi and, Parastrellus hesperus), which have been recorded in association with 5 soft tick species (Ornithodoros yumatensis, O. brodyi, O. hasei, O. dyeri, and O. rossi, respectively; Guzmán-Cornejo et al. 2019).

We identified for the first time the presence of a tick parasitizing R. tumida, particularly the soft tick O. hasei. Although Jones et al. (1972) mention the presence of O. hasei in R. tumida collected in Venezuela (Appendix 1), phylogenetic studies carried out identified the existence of the tumida-parvula species complex. Subsequent phylogenetic studies demonstrated the presence of 10 species of the genus Rhogeesa across the Neotropical region (Baird et al. 2009). In the case of R. tumida, this species has a restricted distribution ranging from northeastern México, through Central America, to the south of Brazil, Bolivia, and Ecuador, whereas the only species described for Venezuela is the tiny yellow bat (Rhogeessa minutilla), species in which the presence of O. hasei has been demonstrated in Colombia (Marinkelle and Grose 1981; Baird et al. 2009; Ceballos 2014). The present work increases the inventory of ectoparasites associated with R. tumida, since there are only historical records of the nycteribiid fly Basilia anomala from México (Guimaraes and D’Andretta 1956) and Guatemala (Theodor 1967) and the myobiid mite Acanthophthirius longus from Guatemala (Uchikawa and Baker 1993). To the best of our knowledge, there are only 3 previous historical records of O. hasei parasitizing members of the genus Rhogeessa: the tiny yellow bat (R. minutilla), one unidentified specimen from Venezuela, and the little yellow bat (R. parvula) from Colombia (Jones et al. 1972; Marinkelle and Grose 1981; Appendix 1). So, this work provides a new parasite–host association for this bat genus.

Our findings add a new location for O. hasei in México: this record represents the most northern finding of O. hasei on the Gulf of México, particularly in the transition zone with the Nearctic region (Guzmán-Cornejo et al. 2019). Furthermore, it is important to clarify that O. hasei is distributed from the north-west of México (Sinaloa) to Argentina and not from the southern part of México to Argentina, as mentioned by other authors (Davoust et al. 2016; Figure 1).

Additionally, this new record adds novel and valuable taxonomic information about the species. Since the description of this taxon in 1972 by Jones et al., there has been an intense debate regarding the taxonomy of this species. The variability in the total length of the specimens from different countries of South America and the Caribbean (Jones et al. 1972) has led to the proposal of the existence of possible cryptic species (Muñoz-Leal et al. 2018). The TCS network (statistical parsimony) revealed the presence of many unique and intermediate haplotypes (probably non-sampled haplotypes) from South American populations of O. hasei (Figure 3). This is consistent with the subsampling of this species throughout the Neotropical region, such as in the case of Amblyomma aureolatum from Brazil (Bitencourth et al. 2021). Our new data will help to elucidate the possible presence of a cryptic species complex or intraspecies variability. It is crucial to continue processing new morphological, molecular, and ecological data about O. hasei in order to clarify their taxonomic status.

Our current work also presents the first record of a Coxiella sp. in O. hasei, and the second one of this bacteria genus in a soft tick associated with bats, since the only previous record is from Ornithodoros peruvianus associated with Desmodus rotundus in Chile (Duron et al. 2015). In addition, our work represents the first molecular typification of Coxiella sp. in México since this bacterial genus was previously detected using Next Generation Sequencing in the soft tick Ornithodoros turicate from the Bolson tortoise (Ghopherus flavimarginatus) in the northern Mapimi Biosphere Reserve (Barraza-Guerrero et al. 2020). However, this technique does not discriminate between C. burnetii and Coxiella endosymbionts. In previous studies, C. burnetii had been detected in solid organs and blood of bats from Brazil (Ferreira et al. 2018). To date, C. burnetii is the only species confirmed to be a vertebrate pathogen, capable of causing a systemic disease, that has been reported in bats from Brazil. The molecular phylogeny of Coxiella identified the presence of 4 clades (named as A-D). All Coxiella clades except one (D) include pathogenic and endosymbiont linages. Recently, Brenner et al. (2021) determined that both groups (C. burnetii and Coxiella endosymbionts) evolved from a common pathogenic ancestor. However, the zoonotic potential of other endosymbiont Coxiella in vertebrates, particularly bats, is unknown. Since no biological samples were taken from the vertebrate host in the present study, it is unknown whether the host is infected with the agent.

On the other hand, Coxiella endosymbionts seem to be very common in soft ticks, especially in the genus Ornithodoros (Duron et al. 2015). Previous studies for the detection of Coxiella failed to demonstrate the presence of this microorganism in O. hasei populations from South America (Tahir et al. 2016). For this reason, our record represents the first molecular identification of Coxiella in ticks associated with bats in the Neotropical region.

Recently, Ca. R. wisemanni was detected at a high prevalence in O. hasei from Argentina, Brazil and French Guinea (Tahir et al. 2016; Luz et al. 2019; Colombo et al. 2020). However, this microorganism was not identified in our study, possibly due to the low number of samples analysed. Yet, its presence was not ruled out, and more studies should be carried out to understand its potential distribution in the most north-eastern populations of O. hasei.

The findings of the present work highlight the need to continue with the systematic study of microorganisms associated with soft ticks from Mexican bats, since very little is known about the microbiome of these ectoparasites, which represent an important component of biodiversity.

Acknowledgements

This paper is part of the requirements for obtaining a Doctoral degree at the Posgrado en Ciencias Biológicas, UNAM of E. Grostieta Rojas. Financing was granted by UNAM-PAPIIT AG201221. She receives a scholarship from CONAHCyT. We are very grateful to the owner and the staff of San Basilio Ecotourism Centre for the facilities to carry out this study. Also, to biology students of Facultad de Ciencias Biológicas y Agropecuarias region Tuxpan (FCBA) for their assistance in the fieldwork. Two anonymous reviewers contributed to improve this manuscript.

Literature cited

Acosta, I., et al. 2016. Ticks (Acari: Ixodidae, Argasidae) from humans, domestic and wild animals in the state of Espírito Santo, Brazil, with notes on rickettsial infection. Veterinary Parasitology, Regional Studies and Reports 3-4:66-69.

Aguilar-Domínguez, M., et al. 2019. Genetic structure analysis of Amblyomma mixtum populations in Veracruz State, México. Ticks and Tick-borne Diseases 10:86-92.

Almeida, A. P., et al. 2012. Coxiella symbiont in the tick Ornithodoros rostratus (Acari: Argasidae). Ticks and Tick-borne Diseases 3:203-206.

Baird, A. B., et al. 2009. Speciation by monobrachial centric fusions: a test of the model using nuclear DNA sequences from the bat genus Rhogeessa. Molecular Phylogenetics and Evolution 50:256-267.

Barraza-Guerrero, S. I., et al. 2020. General microbiota of the soft tick Ornithodoros turicata parasitizing the Bolson Tortoise (Gopherus flavomarginatus) in the Mapimi Biosphere Reserve, México. Biology 9:275.

Bitencourth, K., et al. 2021. Amblyomma aureolatum genetic diversity and population dynamics are not related to Spotted Fever epidemiological scenarios in Brazil. Pathogens 10:1146.

Brenner, A. E., et al. 2021. Coxiella burnetii and related tick endosymbionts evolved from pathogenic ancestors. Genome Biology and Evolution 13:108.

Ceballos, G. (ed.). 2014. Mammals of México. Johns Hopkins University Press. Baltimore, U.S.A.

Colombo, V. C., et al. 2020. First detection of "Candidatus Rickettsia wissemanii" in Ornithodoros hasei (Schulze, 1935) (Acari: Argasidae) from Argentina. Ticks and Tick-Borne Diseases 11:101442.

Cooley, R. A., and G. M. Kohls. 1944. The Argasidae of North America, Central America, and Cuba. The American Midland Naturalist Monograph 1:152.

Davoust, B., et al. 2016. Evidence of Bartonella spp. in blood and ticks (Ornithodoros hasei) of bats, in French Guiana. Vector Borne and Zoonotic Diseases 16:516-519.

de Sousa, R., et al. 2006. Rickettsia sibirica isolation from a patient and detection in ticks, Portugal. Emerging Infectious Diseases 12:1103-1108.

Dick, C. W., et al. 2007. Bolivian Ectoparasites: A Survey of Bats (Mammalia Chiroptera). Comparative Parasitology 74:372-377.

Duron, O., et al. 2015. The recent evolution of a maternally-inherited endosymbiont of ticks led to the emergence of the Q Fever pathogen, Coxiella burnetii. PLoS Pathogens 11:e1004892.

Fairchild, G. B., et al. 1965. The ticks of Panama (Acarina: Ixodoidea). Pp. 167-219 in The Ectoparasites of Panama (Wenzel, W. R., and V. J. Tipton, eds.). R. R. Donnelley and Sons Co. Chicago, U.S.A.

Ferreira, M. S., et al. 2018. Coxiella and Bartonella spp. in bats (Chiroptera) captured in the Brazilian Atlantic Forest biome. BMC Veterinary Research 14:279.

Guimaraes, L. R., and M. A.V. D'Andretta. 1956. Sinopse dos Nycteribiidae (Diptera) do Novo Mondo. Arquivos De Zoologia 10:1-184.

Guzmán-Cornejo, C., et al. 2019. The soft ticks (Parasitiformes: Ixodida: Argasidae) of México: species, hosts, and geographical distribution. Zootaxa 4623:485-525.

Hornok, S., et al. 2019. Molecular detection of vector-borne bacteria in bat ticks (Acari: Ixodidae, Argasidae) from eight countries of the Old and New Worlds. Parasites and Vectors 12:50.

Jones, E. K., et al. 1972. The ticks of Venezuela (Acarina: Ixodoidea) with a key to the species of Amblyomma in the Western Hemisphere. Brigham Young University Science Bulletin, Biological Series 17:1-40.

Kohls, G. M., et al. 1965. The systematics of the subfamily Ornithodorinae (Acarina: Argasidae). II. Identification of the larvae of the Western Hemisphere and descriptions of 3 new species. Annals of the Entomological Society of America 58:331-364.

Luz, H. R., et al. 2019. Detection of “Candidatus Rickettsia wissemanii” in ticks parasitizing bats (Mammalia: Chiroptera) in the northern Brazilian Amazon. Parasitol Research 118:3185-3189.

Mans, B. J., et al. 2019. Argasid and ixodid systematics: Implications for soft tick evolution and systematics, with a new argasid species list. Ticks and Tick-borne Diseases 10:219-240.

Marinkelle, C. J., and E. S. Grose. 1981. A list of ectoparasites of Colombian bats. Revista de Biologia Tropical 29:11-20.

Masuzawa, T., et al. 1997. Identification of rickettsiae isolated in Japan as Coxiella burnetii by 16S rRNA sequencing. International Journal of Systematic Bacteriology 47:883-884.

Matheson, R. 1935. Three new species of ticks, Ornithodoros (Acarina:Ixodoidea). Journal of Parasitology 21:347-353.

Medellín, R. A., et al. 2007. Identificación de los murciélagos de México, Clave de campo, segunda edición. Instituto de Ecología, UNAM. México City, México.

Muñoz-Leal, S., et al. 2016. Ticks infesting bats (Mammalia: Chiroptera) in the Brazilian Pantanal. Experimental & Applied Acarology 69:73-85.

Muñoz-Leal, S., et al. 2018. New records of ticks infesting bats in Brazil, with observations on the first nymphal stage of Ornithodoros hasei. Experimental and Applied Acarology 76:537-549.

Muñoz-Leal, S., et al. 2021. Novel Borrelia genotypes in bats from the Macaregua Cave, Colombia. Zoonoses and Public Health 68:12-18.

Murphy, D. S., et al. 2017. Prevalence and distribution of human and tick infections with the Ehrlichia muris-Like agent and Anaplasma phagocytophilum in Wisconsin, 2009-2015. Vector Borne and Zoonotic Diseases 17:229-236.

Nava, S., et al. 2007. The ticks (Acari: Ixodida: Argasidae, Ixodidae) of Paraguay. Annals of Tropical Medicine and Parasitology 101:255-270.

Norman, A. F., et al. 1995. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene. Journal of Clinical Microbiology 33:1797-1803.

Norris, D. E., et al. 1996. Population genetics of Ixodes scapularis (Acari: Ixodidae) based on mitochondrial 16S and 12S genes. Journal of Medical Entomology 33:78-89.

Ossa-López, P. A., et al. 2023. Morphological and molecular confirmation of Ornithodoros hasei (Schulze, 1935) (Acari: Argasidae) in Colombia. Ticks and Tick-Borne Diseases 14:102142.

Parola, P., and D. Raoult. 2001. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clinical Infectious Diseases 32:897-928.

Rudenko, N., et al. 2009. Borrelia carolinensis sp. nov., a new (14th) member of the Borrelia burgdorferi sensu lato complex from the southeastern region of the United States. Journal of Clinical Microbiology 47:134-141.

Sánchez-Montes, S., et al. 2016. Rickettsia lusitaniae associated with Ornithodoros yumatensis (Acari: Argasidae) from 2 caves in Yucatan, México. Ticks and Tick-Borne Diseases 7:1097-1101.

Sándor, A. D., et al. 2021. Argasid ticks of palearctic bats: distribution, host selection, and zoonotic importance. Frontiers Veterinary Science 8:684737.

Schulze, P. 1935. Zur vergleichenden Anatomie der Zecken. (Das Sternale, die Mundwerkzeuge, Analfurchen und Analbeschilderung ihre Bedeutung, Ursprünglichkeit und Luxurieren). Zeitschrift für Morphologie und Ökologie der Tiere 30:1-40.

Tahir, D., et al. 2016. New Rickettsia species in soft ticks Ornithodoros hasei collected from bats in French Guiana. Ticks and Tick-Borne Diseases 7:1089-1096.

Theodor, O. 1967. An illustrated catalogue of the Rothschild collection of Nycteribiidae (Diptera) in the British Museum (Natural History) with keys and short descriptions for the identification of subfamilies, general, species, and subspecies. London, England.

Uchikawa, K., and A. Baker. 1993. A new classification for the subgenera of the genus Acanthophthirius Perkins, with descriptions of twelve new taxa (Acarina, Trombidiformes, Myobiidae). Systematic Parasitology 25:81-108.

Ujvari, B., et al. 2004. High prevalence of Hepatozoon spp. (Apicomplexa: Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of Parasitology 90:670-672.

Associated editor: Gloria Tapia Ramírez.

Submitted: March 6, 2024; Reviewed: April 9, 2024.

Accepted: April 30, 2024; Published on line: May 27, 2024.

Appendix 1

List of known host species and localities of the soft tick Ornithodoros hasei across the Neotropical region. NR: Not recorded; F: Female; M: Male; N: Nymph; L: Larvae.

Order	Family	Scientific name	Common name	Country	Locality	Tick stage	Collection date	Bacterial detected	Reference
Chiroptera	Emballonuridae	Peropteryx sp.	-	Venezuela	10 km S, 18 km W Machiques, Kasmera, Zulia	2L	15 April, 1968	NR	Jones et al. 1972
	Molossidae	Eumops sp.	-	Bolivia	San Joaquin, Beni and Magdalena	NR	March-September, 1963	NR	Kohls et al. 1965
		Molossus bondae	Bonda Mastiff Bat	Venezuela	About 10 km NW Urama, Yaracuy	1L	14 March, 1966	NR	Jones et al. 1972
		Molossus bondae	Bonda Mastiff Bat	Venezuela	Montalbán, Carabobo	2L	5 September, 1967	NR	Jones et al. 1972
		Molossus molossus	Pallas's mastiff bat	Colombia	Vereda El Socorro, Finca Los Trompillos, municipality of Arauca, Department of Arauca, Orinoquia region	11L	1 November 2021	NR	Ossa-López et al. 2023
		Molossus molossus	Pallas's mastiff bat	Colombia	NR	3	NR	NR	Marinkelle and Grose 1981
		Molossus nigricans	Ebon Mastiff Bat	Mexico	Piste, Yucatán	43L	July 20-21, 1962	NR	Kohls et al. 1965
		Molossus rufus	Black Mastiff Bat	Venezuela	1/4 km N San Juan, E side Río Manapiare, Harder	4L	5 July, 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	14 km E Cumaná, Hda. Guanital, Sucre	12L	9 December, 1966	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	2 km N Tamanaco, near San Juan Río Manapiare, Harder	1L	19 July, 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	2 km N Tamanaco, near San Juan, Río Manapiare, Harder	2L	17 July, 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	2-3 km N, 4 km W Caripe, San Agustín, Monagas	36L	26 June-07 July 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	38 km NW Pto. Paez, Hato Cariben, Río Cinaruco, Apure	1M, 1N	17 January, 1966	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	38 km NW Pto. Paez, Río Cinaruco, Apure	1F, 2N, 1L	17 January, 1966	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	46 km NE Pto. Paez, Hato Cariben, Río Cinaruco, Apure	1M, 1N, 1L	13,17 January, 1965	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	46 km NE Pto. Paez, Hato Cariben, Río Cinaruco, Apure	1L	28 July, 1965	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	59 km SE , km 74, El Manaco, Bolivar	35L	8-17 June, 1966	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	Ca. 2 km N Tamanaco, near San Juan, Río Manapiare, Harder	7L	24 July, 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	Near San Agustín, Monagas	25L	8 July 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	Near Tamanaco, ca. 4 km NE San Juan, Río Manapiare, Harder	14L	14,19 July, 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	Tamanaco, ca. 4 km NE San Juan, Río Manapiare, Harder	2L	14 July, 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	Tamanaco, ca. 4 km NE San Juan, Río Manapiare, T. F. Amazonas	6L	14 July, 1967	NR	Jones et al. 1972
		Molossus rufus	Black Mastiff Bat	Venezuela	Tamanaco, near San Juan, Río Manapiare, Harder	2L	25 July, 1967	NR	Jones et al. 1972
		Molossops temminckii	Dwarf Dog-faced Bat	Argentina	Sociedad Rural “Las Colonias”, Esperanza city	5L	January 2018	NR	Colombo et al. 2020
		Mormoops megalophylla	Peters's Ghost-faced Bat	Venezuela	9 km N, 4 km E Guiria near Río Salado, Sucre	1L	7 July, 1967	NR	Jones et al. 1972
		Neoplatymops mattogrossensis	Mato Grosso Dog-faced Bat	Venezuela	33 km SSE Puerto Ayacucho, El Raudal, Harder	25L	4, 10 October, 1967	NR	Jones et al. 1972
		Tadarida sp.	-	Venezuela	38 km NW Pto. Paez, Río Cinaruco, Apure	1L	21 January, 1966	NR	Jones et al. 1972
		Tadarida sp.	-	Venezuela	Boca Mavaca, Río Orinoco, 84 km SSE Esperalda, Harder	5L	14 Frebruary, 1966	NR	Jones et al. 1972
		Tadarida sp.	-	Venezuela	Río Cunucunuma, near Belén, Harder	3L	13 January, 1967	NR	Jones et al. 1972
	Noctilionidae	Noctilio albiventris	Lesser Bulldog Bat	Brazil	Mato Grosso do Sul state	3L	2006-2008	NR	Muñoz-Leal et al. 2018
		Noctilio albiventris	Lesser Bulldog Bat	Colombia	Vereda El Socorro, Finca Los Trompillos, municipality of Arauca, Department of Arauca, Orinoquia region	86L	31 October 2021, 1 November 2021	NR	Ossa-López et al. 2023
		Noctilio albiventris	Lesser Bulldog Bat	Colombia	Vereda El Socorro, Finca Marsella, municipality of Arauca, Department of Arauca, Orinoquia region	43L	3 November 2021	NR	Ossa-López et al. 2023
		Noctilio albiventris	Lesser Bulldog Bat	Colombia	NR	4	NR	NR	Marinkelle and Grose 1981
		Noctilio albiventris	Lesser Bulldog Bat	French Guiana	Saint-Jean-du-Maroni	354L	January 2013	31L Candidatus Rickettsia wissemanii	Tahir et al. 2016
		Noctilio albiventris	Lesser Bulldog Bat	French Guiana	Saint-Laurent-du-Maroni	355L	January and February 2013	4L Bartonella sp.	Davoust et al. 2016
		Noctilio albiventris	Lesser Bulldog Bat	Trinidad	Santa Cruz,6 km by road W of Ascención	7L	13 August 1985	NR	Dick et al. 2007
		Noctilio leporinus	Greater Bulldog Bat	Bolivia	San Joaquin, Beni and Magdalena	Aprox 575L	March-September, 1963	NR	Kohls et al. 1965
		Noctilio leporinus	Greater Bulldog Bat	Brazil	Mato Grosso do Sul state	NR	2006-2008	NR	Muñoz-Leal et al. 2016
		Noctilio leporinus	Greater Bulldog Bat	Brazil	Serinhaém, Pernambuco	19L, 2N	nov, 2016	NR	Muñoz-Leal et al. 2018
		Noctilio leporinus	Greater Bulldog Bat	Colombia	NR	2	NR	NR	Marinkelle and Grose 1981
		Noctilio leporinus	Greater Bulldog Bat	Costa Rica	9 mi ENE of Puerto Golfito, Puntarenas Province	29L	March 15, 1963	NR	Kohls et al. 1965
		Noctilio leporinus	Greater Bulldog Bat	Nicaragua	Rama, Bluefiels	2L	April 29, 1963	NR	Kohls et al. 1965
		Noctilio leporinus	Greater Bulldog Bat	Panama	Yard of the Panama Hospital, Panama City	32L	March 17, 1931	NR	Matheson 1935
		Noctilio leporinus	Greater Bulldog Bat	Panama	Summit Canal Zone	NR	September 30, 1932	NR	Matheson 1935
		Noctilio leporinus	Greater Bulldog Bat	Panama	Pacora	1N, several larvae	June 21, 22, July 26, 1961	NR	Fairchild et al. 1965
		Noctilio leporinus	Greater Bulldog Bat	Panama	Navy firing point, Galeta Point, Canal Zone	2N	November 19, 1959	NR	Fairchild et al. 1965
		Noctilio leporinus	Greater Bulldog Bat	Paraguay	Fortín Juan de Zalazar	3L	25 September 1973	NR	Nava et al. 2007
		Noctilio leporinus	Greater Bulldog Bat	Paraguay	Fortín Juan de Zalazar	2L	27 September 1973	NR	Nava et al. 2007
		Noctilio leporinus	Greater Bulldog Bat	Trinidad	Avocat	10L**	September 21, 1961	NR	Kohls et al. 1965
		Noctilio leporinus	Greater Bulldog Bat	Trinidad	North Manzanilla	21L	February 28, 1957	NR	Kohls et al. 1965
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	19 km NW Urama, Yaracuy	50L	9 March, 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	2 km N Tamanaco, near San Juan Río Manapiare, Harder	75L	18 July, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	2 km N Tamanaco, near San Juan, Río Manapiare, T. F. Amazonas	88L	17-19 August, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	20 km SSE Puerto Ayacucho Las Queseras, Harder	8L	24 September, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	23 km NW Valera, near Agua Santa, Trujillo	8L	24 August, 1965	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	35 km NW Pto. Cabello, Boca de Yaracuy, Yaracuy and Falcón	92L	22, 29 October, 1965; 2 October, 1965	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	38 km NW Pto. Paez, Río Cinaruco, Apure	255L	17 January 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	42 km WNW ENcontrados, El Rosario, Zulia	4L	5 March, 1968	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	46 km NE Pto. Paez, Hato Caribean, Rio Cinaruco, Apure	2M, 4F, 3N, 863L	15 July 1965-17 January, 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	5 km E Río Chico, nr. Puerto Tuy, Miranda	59L	5, 17 September, 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	About 10 km NW Urama, Yaracuy	1L	11 March, 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	About 10 km NW Urama, Yaracuy	3L	14 March, 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	Moracoy, near San Juan, W side Río Manapiare, Harder	105L	24 July, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	Near Moracoy, ca. 15 km down Río Manapiare from San Juan, Harder	100L	14 July, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	Near San Juan, E side Rio Manapiare, Harder	1L	19 July, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	San Juan, Río Manapiare, Harder	57L	14 July, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	San Juan Río Manapiare, Harder	100L	20 July, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	W side Río Manapiare. near San Juan, Harder	200L	24 July, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	Yaracuy-Carabobo border, NW of Urama, Yaracuy and Carabobo	54L	17 March, 1966	NR	Jones et al. 1972
		Noctilio leporinus/Myotis albescens	Greater Bulldog Bat/Silver-tipped Myotis	Venezuela	Ca. 2 km N Tamanaco, nr. San Juan, Río Manapiare, Harder	11L	18, 26 July, 1967	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	10 km E Río Chico nr. Ticarigua La Laguna, Miranda	50L	9 November, 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	21 km E Cumaná, Hda. Tunantal, Sucre	51L	10, 17 December, 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	38 km NW Pto. Paez, Río Cinaruco, Apure	1L	13 January, 1966	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	42 km WNW ENcontrados, El Rosario, Zulia	2L	5, 28 March, 1968	NR	Jones et al. 1972
		Noctilio leporinus	Greater Bulldog Bat	Venezuela	5 km E Río Chico nr. Puerto Tuy, Miranda	5L	17 November, 1966	NR	Jones et al. 1972
		Noctilio sp.	NR	Panama	Gamboa (canal Zone), pipeline road	NR	May 14, 1962	NR	Fairchild et al. 1965
	Phyllostomidae	Artibeus jamaicensis	Jamaican Fruit-eating Bat	Colombia	NR	54	NR	NR	Marinkelle and Grose 1981
		Artibeus jamaicensis s.l.	Jamaican Fruit-eating Bat	Venezuela	14 km S, 45 Km E Caicara, Hato La Florida, Bolivar	35L	NR	NR	Jones et al. 1972
		Artibeus jamaicensis s.l.	Jamaican Fruit-eating Bat	Venezuela	5 km NW Guasipati, Bolivar	6L	29 April, 1966	NR	Jones et al. 1972
		Artibeus jamaicensis s.l.	Jamaican Fruit-eating Bat	Venezuela	San Juan Río Manapiare, Harder	1L	24 July, 1967	NR	Jones et al. 1972
		Artibeus lituratus	Great Fruit-eating Bat	Brazil	Pinheiros, Espírito Santo	17L	2012	NR	Acosta et al. 2016
		Artibeus lituratus	Great Fruit-eating Bat	Costa Rica	Majica Ranch, Guanacaste Province	16L	August 10, 1960	NR	Kohls et al. 1965
		Artibeus planirostris	Flat-faced Fruit-eating Bat	Brazil	Mato Grosso do Sul state	289 L	2006-2008	NR	Muñoz-Leal et al. 2016
		Artibeus planirostris	Flat-faced Fruit-eating Bat	Brazil	Private Reserve of the Natural Patrimony Serra das Almas, Municipality of Crateús, state of Ceará	296L	July 2012, February 2013	NR	Luz et al. 2019
		Artibeus planirostris	Flat-faced Fruit-eating Bat	Brazil	southeastern region of the Amapá state	160L	October 2016 and November 2017	1 pool Candidatus R. wissemanii	Luz et al. 2019
		Carolia perspicillata	Seba's Short-tailed Bat	Brazil	Tamandaré, Pernambuco	34L, 17N	May-15	NR	Muñoz-Leal et al. 2018
		Carollia perspicillata	Seba's Short-tailed Bat	Venezuela	W side Río Manapiare, near San Juan, Harder	1L	24 July, 1967	NR	Jones et al. 1972
		Carollia sp.	-	Venezuela	Near Tamanaco, ca. 4 km NE San Juan, Río Manapiare, Harder	1L	19 July, 1967	NR	Jones et al. 1972
		Chiroderma salvini	Salvin's Big-eyed Bat	Venezuela	3 km N, 4 km W Caripe, San Agustin, Monagas	1L	27 July, 1967	NR	Jones et al. 1972
		Desmodus rotundus	Common Vampire Bat	Venezuela	35 km NW Pto. Cabello, Boca de Yaracuy, Yaracuy and Falcón	1L	30 October, 1965	NR	Jones et al. 1972
		Desmodus rotundus	Common Vampire Bat	Venezuela	38 km NW Pto. Paez, Río Cinaruco, Apure	1L	13 January, 1966	NR	Jones et al. 1972
		Glossophaga longirostris	Miller's Long-tongued Bat	Venezuela	46 km NE Pto. Paez, Hato Cariben, Rio Cinaruco, Apure	1L	July 14 1965	NR	Jones et al. 1972
		Glossophaga soricina	Pallas's Long-tongued Bat	Brazil	Serinhaém, Pernambuco	3L	November, 2008	NR	Muñoz-Leal et al. 2018
		Lonchorhina orinocensis	Orinocoan Sword-nosed Bat	Venezuela	46 km NE Pto. Paez, Hato Cariben, Rio Cinaruco, Apure	1L	24 July 1965	NR	Jones et al. 1972
		Lophostoma brasiliense	Pygmy Round-eared Bat	Brazil	Private Reserve of the Natural Patrimony Serra das Almas, Municipality of Crateús, state of Ceará	6L	July 2012, February 2013	NR	Luz et al. 2019
		Lophostoma silvicola	White-Throated Round-Eared Bat	Panama	Las Palmitas (Los Santos)	NR	January-February, 1962	NR	Fairchild et al. 1965
		Gardnerycteris crenulatum	Striped Hairy-nosed Bat	Brazil	Mato Grosso do Sul state	3L	2006-2008	NR	Muñoz-Leal et al. 2016
		Gardnerycteris crenulatum	Striped Hairy-nosed Bat	Venezuela	19 km NW Urama Km 40, Yaracuy and Carabobo	5L	26 October, 1965	NR	Jones et al. 1972
		Phyllostomus discolor	Pale spear-nosed bat	Colombia	NR	1	NR	NR	Marinkelle and Grose 1981
		Phyllostomus hastatus	Greater Spear-nosed Bat	Brazil	Mato Grosso do Sul state	55L	2006-2008	NR	Muñoz-Leal et al. 2016
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	13 km NW Urama, Río Yaracuy, Yaracuy	4L	20 March, 1966	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	23 km NW Valera, near Agua Santa, Trujillo	2L	18 October, 1965	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	5 km S, 25 km E Carúpano, Manacal, Sucre	1L	3 August, 1966	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	6 km N Urama, Carabobo	9L	17 March, 1966	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	About 11 km NW Urama, near El Central, Yaracuy	2L	14 March, 1966	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	Moracoy, near Río Manapiare, Harder	25L	13 July, 1967	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	San Juan, Río Manapiare, Harder	1L	17 July, 1967	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	Near Moracoy, 15 km down Río Manapiare from San Juan, Harder	1L	NR	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	San Juan, Río Manapiare, Harder	1L	17 July, 1967	NR	Jones et al. 1972
		Phyllostomus hastatus	Greater Spear-nosed Bat	Venezuela	San Juan, Río Manapiare, Harder	50L	17 July, 1967	NR	Jones et al. 1972
		Platyrrhinus helleri	Heller's Broad-Nosed Bat	Panama	Las Palmitas (Los Santos)	NR	January-February, 1962	NR	Fairchild et al. 1965
		Platyrrhinus lineatus	White-lined Broad-nosed Bat	Brazil	Mato Grosso do Sul state	12 L	2006-2008	NR	Muñoz-Leal et al. 2016
		Sturnira giannae	Gianna's Yellow-shouldered Bat	Venezuela	4 km NNW Caracas, Distrito Federal	8L	23 July, 1965	NR	Jones et al. 1972
		Sturnira lilium	Little Yellow-shouldered Bat	Brazil	Caetité, Bahía	19L	December 2014	NR	Muñoz-Leal et al. 2018
		Sturnira lilium	Little Yellow-shouldered Bat	Venezuela	14 km E Cumaná, Hda. Guanital, Sucre	30L	8-9 December, 1966	NR	Jones et al. 1972
		Tonatia bidens	Greater Round-eared Bat	Brazil	Private Reserve of the Natural Patrimony Serra das Almas, Municipality of Crateús, state of Ceará	10L	July 2012, February 2013	NR	Luz et al. 2019
		Tonatia sp.	-	Brazil	Private Reserve of the Natural Patrimony Serra das Almas, Municipality of Crateús, state of Ceará	4L	July 2012, February 2013	NR	Luz et al. 2019
		Uroderma bilobatum	Tent-Making Bat	Panama	Las Palmitas (Los Santos)	NR	January-February, 1962	NR	Fairchild et al. 1965
		Uroderma magnirostrum	Brown Tent-making Bat	Venezuela	Near San Juan, Río Manapiare, Harder	20L	17 July, 1967	NR	Jones et al. 1972
	Vespertilionidae	Aeorestes cinereus	Hoary bat	Colombia	NR	1	NR	NR	Marinkelle and Grose 1981
		Eptesicus diminutus	Diminutive Serotine	Argentina	Sociedad Rural “Las Colonias”, Esperanza city	3L	January 2018	3L Candidatus “R. wissemanii”	Colombo et al. 2020
		Eptesicus furinalis	Argentinian Brown Bat	Argentina	Cululú river banks, town of Cululú	4L	January 2018	NR	Colombo et al. 2020
		Eptesicus furinalis	Argentinian Brown Bat	Argentina	Santa Fe de la Veracruz city	3L	November 2017	NR	Colombo et al. 2020
		Eptesicus orinocensis	Orinoco brown bat	Colombia	Vereda El Socorro, Finca Los Trompillos, municipality of Arauca, Department of Arauca, Orinoquia region	33L	1 November 2021	NR	Ossa-López et al. 2023
		Eptesicus sp.	-	Argentina	Santa Fe de la Veracruz city	7L	November 2017	NR	Colombo et al. 2020
		Myotis nigricans	Black Myotis	Venezuela	Gueiira	NR	NR	NR	Schulze 1935
		Myotis velifer velifer	Cave Myotis	Mexico	Santa Lucía, Sinaloa	1L	July 28, 1963	NR	Kohls et al. 1965
		Rhogeessa minutilla	Tiny Yellow Bat	Venezuela	114 km N, 32 km W Maracaibo near Cojoro, Zulia	4L	24 June, 1968	NR	Jones et al. 1972
		Rhogeessa parvula	Little yellow bat	Colombia	NR	2	NR	NR	Marinkelle and Grose 1981
		Rhogeessa sp.	-	Venezuela	19 km NW Urama, Yaracuy	4L	9 March, 1966	NR	Jones et al. 1972
Rodentia	Cricetidae	Necromys urichi	Northern Grass Mouse	Venezuela	3 km N, 4 km W Caripe, San Agustín, Monagas	1L	24 June 1967	NR	Jones et al. 1972
Questing	NR	Tree hole	NR	Brazil	Marajó Island, Belém, Pará	1F	June 1941	NR	Cooley and Kohls 1944
	NR	Bat guano	NR	Panama	Pacora	Members of all life cycle	June 21, 22, July 26, 1961	NR	Fairchild et al. 1965

Appendix 2

Primers used for molecular detection of tickborne pathogens.

Parasite	Gene	Primers	Size (bp)	Positive control	Reference
Protozoa
Babesia spp.	18S rDNA	BAB01 CCGTGCTAATTGTAGGGCTAATACA	571	Babesia bigemina [MZ798903]	Almeida et al. 2012
		BAB02 GCTTGAAACACTCTARTTTTCTCAAAG
Hepatozoon spp.	18S rDNA	HepF300 GTTTCTGACCTATCAGCTTTCGACG	495	Hepatozoon spp. from Crotalus molossus [MT385834]	Ujvari et al. 2004
		HepR900 CAAATCTAAGAATTTCACCTCTGAC
Bacteria
Anaplasma/Ehrlichia spp.	16S rDNA	EHR01F GCCTAACACATGCAAGTCGAACG	495	Anaplasma marginale [MN453603]	Murphy et al. 2017
		EHR02R GCCCAATAATTCCGAACAACG
Bartonella spp.	gltA	BhCS781.p GGGGACCAGCTCATGGTGG	379	Bartonella quintana [OM108475]	Norman et al. 1995
		BhCS1137.n AATGCAAAAAGAACAGTAAACA
Borrelia spp.	flaB	FlaoutF AARGAATTGGCAGTTCAATC	470	Borrelia burgdorferi [MK370994]	Rudenko et al. 2009
		FlaoutR GCATTTTCWATTTTAGCAAGTGATG
Coxiella spp.	23S rDNA	QR-FO ATTGAAGAGTTTGATTCTGG	1000	Coxiella endosymbiont of Amblyomma mixtum [OM307605]	Masuzawa et al. 1997
		QR-RO CGGCCTCCCGAAGGTTAG
Rickettsia spp.	gltA	RpCS.415 GCTATTATGCTTGCGGCTGT	806	Rickettsia amblyommatys [MW539675]	de Sousa et al. 2006
		RpCS.1220 TGCATTTCTTTCCATTGTGC